Review




Structured Review

Santa Cruz Biotechnology pdk2
A , PDH enzyme activity was measured across groups in isolated cardiac mitochondria from fed and fasted, control and cKO hearts (n=7–9). B , Pyruvate and malate‐dependent mitochondrial respiration was measured as oxygen consumption in the ADP‐dependent state (state 3; n=7–9). C and D , Relative abundance of total PDH ( C ) and p‐PDH (serine 293; D ) were measured by western blot in the mitochondrial fraction of hearts (n=7–9). E , The ratio of p‐PDH (serine 293) to total PDH was taken. F , Representative western blots are shown for phosphorylated (serine 293) and total PDH. G , PDK4 abundance was measured by western blot in whole‐heart homogenate (n=7–9). H and I , PDK1 ( H ) and <t>PDK2</t> ( I ) abundances were measured by western blot in whole heart homogenate (n=5–6). J , Palmitoylcarnitine and malate‐dependent respiration was measured in state 3 (n=7–9). K , The ratio of PC/Pyr‐dependent State 3 respiration was calculated using measures from ( B ) and ( J ) (n=7–9). A statistical outlier in PC and malate‐dependent respiration was detected in the fed control group via a robust outlier detection test with Q=1% and excluded in panels ( J ) and ( K ). L , CPT1 activity was measured in isolated mitochondria (n=5). Statistics were performed as 2‐way ANOVA. Individual comparisons were also performed between the fed and fasted states within genotype groups by unpaired Student t test. Data are shown as mean±SD. Not significant (ns) indicates P >0.05. * P ≤0.05, ** P ≤0.01, *** P ≤0.001. cKO indicates PFKFB2 knockout; CON, control; CPT1, carnitine palmitoyl transferase 1; PC, palmitoyl carnitine; PDH, pyruvate dehydrogenase; PDK, pyruvate dehydrogenase kinase; PFKFB2, phosphofructokinase‐2/fructose‐2,6‐bisphosphatase 2; p‐PDH, phosphorylated pyruvate dehydrogenase; Pyr, pyruvate; and Ser, serine.
Pdk2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 42 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk2/pmc12887202-10-0-3?v=Santa+Cruz+Biotechnology
Average 93 stars, based on 42 article reviews
pdk2 - by Bioz Stars, 2026-08
93/100 stars

Images

1) Product Images from "PFKFB2 Is Pivotal for Metabolic Flexibility and Differential Glucose Utilization"

Article Title: PFKFB2 Is Pivotal for Metabolic Flexibility and Differential Glucose Utilization

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

doi: 10.1161/JAHA.125.043921

A , PDH enzyme activity was measured across groups in isolated cardiac mitochondria from fed and fasted, control and cKO hearts (n=7–9). B , Pyruvate and malate‐dependent mitochondrial respiration was measured as oxygen consumption in the ADP‐dependent state (state 3; n=7–9). C and D , Relative abundance of total PDH ( C ) and p‐PDH (serine 293; D ) were measured by western blot in the mitochondrial fraction of hearts (n=7–9). E , The ratio of p‐PDH (serine 293) to total PDH was taken. F , Representative western blots are shown for phosphorylated (serine 293) and total PDH. G , PDK4 abundance was measured by western blot in whole‐heart homogenate (n=7–9). H and I , PDK1 ( H ) and PDK2 ( I ) abundances were measured by western blot in whole heart homogenate (n=5–6). J , Palmitoylcarnitine and malate‐dependent respiration was measured in state 3 (n=7–9). K , The ratio of PC/Pyr‐dependent State 3 respiration was calculated using measures from ( B ) and ( J ) (n=7–9). A statistical outlier in PC and malate‐dependent respiration was detected in the fed control group via a robust outlier detection test with Q=1% and excluded in panels ( J ) and ( K ). L , CPT1 activity was measured in isolated mitochondria (n=5). Statistics were performed as 2‐way ANOVA. Individual comparisons were also performed between the fed and fasted states within genotype groups by unpaired Student t test. Data are shown as mean±SD. Not significant (ns) indicates P >0.05. * P ≤0.05, ** P ≤0.01, *** P ≤0.001. cKO indicates PFKFB2 knockout; CON, control; CPT1, carnitine palmitoyl transferase 1; PC, palmitoyl carnitine; PDH, pyruvate dehydrogenase; PDK, pyruvate dehydrogenase kinase; PFKFB2, phosphofructokinase‐2/fructose‐2,6‐bisphosphatase 2; p‐PDH, phosphorylated pyruvate dehydrogenase; Pyr, pyruvate; and Ser, serine.
Figure Legend Snippet: A , PDH enzyme activity was measured across groups in isolated cardiac mitochondria from fed and fasted, control and cKO hearts (n=7–9). B , Pyruvate and malate‐dependent mitochondrial respiration was measured as oxygen consumption in the ADP‐dependent state (state 3; n=7–9). C and D , Relative abundance of total PDH ( C ) and p‐PDH (serine 293; D ) were measured by western blot in the mitochondrial fraction of hearts (n=7–9). E , The ratio of p‐PDH (serine 293) to total PDH was taken. F , Representative western blots are shown for phosphorylated (serine 293) and total PDH. G , PDK4 abundance was measured by western blot in whole‐heart homogenate (n=7–9). H and I , PDK1 ( H ) and PDK2 ( I ) abundances were measured by western blot in whole heart homogenate (n=5–6). J , Palmitoylcarnitine and malate‐dependent respiration was measured in state 3 (n=7–9). K , The ratio of PC/Pyr‐dependent State 3 respiration was calculated using measures from ( B ) and ( J ) (n=7–9). A statistical outlier in PC and malate‐dependent respiration was detected in the fed control group via a robust outlier detection test with Q=1% and excluded in panels ( J ) and ( K ). L , CPT1 activity was measured in isolated mitochondria (n=5). Statistics were performed as 2‐way ANOVA. Individual comparisons were also performed between the fed and fasted states within genotype groups by unpaired Student t test. Data are shown as mean±SD. Not significant (ns) indicates P >0.05. * P ≤0.05, ** P ≤0.01, *** P ≤0.001. cKO indicates PFKFB2 knockout; CON, control; CPT1, carnitine palmitoyl transferase 1; PC, palmitoyl carnitine; PDH, pyruvate dehydrogenase; PDK, pyruvate dehydrogenase kinase; PFKFB2, phosphofructokinase‐2/fructose‐2,6‐bisphosphatase 2; p‐PDH, phosphorylated pyruvate dehydrogenase; Pyr, pyruvate; and Ser, serine.

Techniques Used: Activity Assay, Isolation, Control, Western Blot, Knock-Out



Similar Products

86
Sangon Biotech tcccgtaaccctctagggaata sangon biotech n a primer pdk2 forward
Tcccgtaaccctctagggaata Sangon Biotech N A Primer Pdk2 Forward, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk2/pm42054210-662-136-137?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
tcccgtaaccctctagggaata sangon biotech n a primer pdk2 forward - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Sangon Biotech atgaaagagatcaacctgcttcc sangon biotech n a primer pdk2 reverse
Atgaaagagatcaacctgcttcc Sangon Biotech N A Primer Pdk2 Reverse, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk2/pm42054210-662-143-144?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
atgaaagagatcaacctgcttcc sangon biotech n a primer pdk2 reverse - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Servicebio Inc antibody against pdk2
Antibody Against Pdk2, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk2/10__1016_slash_j__aquaculture__2026__743947-116-11-15?v=Servicebio+Inc
Average 86 stars, based on 1 article reviews
antibody against pdk2 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

93
Proteintech anti pdk2
Anti Pdk2, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk2/pm41865618-47-0-12?v=Proteintech
Average 93 stars, based on 1 article reviews
anti pdk2 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

85
Thermo Fisher gene exp pdk2 rn00446679 m1
A-D. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested and subjected to total RNA extraction and qPCR for the indicated genes. (A-B) n=9,11 ( Redd1) , n=12,12 ( Pdk1, <t>Pdk2,</t> Pdp1 ), n=10,12 ( Pdk3 ), and n=11,12 ( Pdk4, Pdp2 ), unpaired t test, 2-way ANOVA. (C-D) n=3,3,3,4 ( Redd1, Pdk1, Pdk2, Pdk3, Pdp1, Pdp2 ) and n=3,3,3,3 ( Pdk4 ), 1-way ANOVA, 2-way ANOVA. E-J. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested, lysed, and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total PDH, and plotted. (E-G) n=10,19 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. (H-J) n=5,6 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.
Gene Exp Pdk2 Rn00446679 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk2/bio_rxiv__64898__2026__03__16__710895-79-51-15?v=Thermo+Fisher
Average 85 stars, based on 1 article reviews
gene exp pdk2 rn00446679 m1 - by Bioz Stars, 2026-08
85/100 stars
  Buy from Supplier

94
Thermo Fisher gene exp pdk2 hs04965351 m1
A-D. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested and subjected to total RNA extraction and qPCR for the indicated genes. (A-B) n=9,11 ( Redd1) , n=12,12 ( Pdk1, <t>Pdk2,</t> Pdp1 ), n=10,12 ( Pdk3 ), and n=11,12 ( Pdk4, Pdp2 ), unpaired t test, 2-way ANOVA. (C-D) n=3,3,3,4 ( Redd1, Pdk1, Pdk2, Pdk3, Pdp1, Pdp2 ) and n=3,3,3,3 ( Pdk4 ), 1-way ANOVA, 2-way ANOVA. E-J. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested, lysed, and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total PDH, and plotted. (E-G) n=10,19 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. (H-J) n=5,6 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.
Gene Exp Pdk2 Hs04965351 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk2/bio_rxiv__64898__2026__03__16__710895-79-49-15?v=Thermo+Fisher
Average 94 stars, based on 1 article reviews
gene exp pdk2 hs04965351 m1 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

94
Thermo Fisher gene exp pdk2 hs00176865 m1
A) Immunoblot analysis of senescence-associated signals p21 (normalized to ß-actin) upregulated in dcSSc FB than HC and post-ASCT (N: HC=5, dcSSc=8 and post-ASCT=6). B) After seeding equal numbers of cells, FB growth was quantified by cell counts, revealing a reduced growth rate in dcSSc FB compared with HC and post-ASCT. (N: HC=5, dcSSc=5 and post-ASCT=5, independent biological replicates). C) PDK1 and D) <t>PDK2</t> mRNA levels are not different between HC and dcSSc FB as determined by qRT-PCR analysis.
Gene Exp Pdk2 Hs00176865 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk2/bio_rxiv__64898__2026__02__17__706443-66-35-3?v=Thermo+Fisher
Average 94 stars, based on 1 article reviews
gene exp pdk2 hs00176865 m1 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

93
Proteintech pyruvate dehydrogenase kinase 2 pdk2
Influence of Que on the glycolysis and energy metabolism-related protein expression level by western blotting and RT-qPCR in SHI-1 cells (mean ± SD, n = 3) . (A) Que down-regulated the expression of c-Myc, GLUT1, HK2, PKM2, LDHA, and <t>PDK2</t> proteins in SHI-1 cells. (B) The expression of AMPK, mTOR, and p-mTOR protein in SHI-1 cells was significantly reduced after the treatment of Que. (C) Que decreased mRNA expression of c-Myc, GLUT1, HK2, PKM2, LDHA, and PDK2 in SHI-1 cells (mean ± SD, n=3). * P < 0.5, ** P < 0.01 vs untreated control group.
Pyruvate Dehydrogenase Kinase 2 Pdk2, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk2/pmc12688951-81-24-60?v=Proteintech
Average 93 stars, based on 1 article reviews
pyruvate dehydrogenase kinase 2 pdk2 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology pdk2
A , PDH enzyme activity was measured across groups in isolated cardiac mitochondria from fed and fasted, control and cKO hearts (n=7–9). B , Pyruvate and malate‐dependent mitochondrial respiration was measured as oxygen consumption in the ADP‐dependent state (state 3; n=7–9). C and D , Relative abundance of total PDH ( C ) and p‐PDH (serine 293; D ) were measured by western blot in the mitochondrial fraction of hearts (n=7–9). E , The ratio of p‐PDH (serine 293) to total PDH was taken. F , Representative western blots are shown for phosphorylated (serine 293) and total PDH. G , PDK4 abundance was measured by western blot in whole‐heart homogenate (n=7–9). H and I , PDK1 ( H ) and <t>PDK2</t> ( I ) abundances were measured by western blot in whole heart homogenate (n=5–6). J , Palmitoylcarnitine and malate‐dependent respiration was measured in state 3 (n=7–9). K , The ratio of PC/Pyr‐dependent State 3 respiration was calculated using measures from ( B ) and ( J ) (n=7–9). A statistical outlier in PC and malate‐dependent respiration was detected in the fed control group via a robust outlier detection test with Q=1% and excluded in panels ( J ) and ( K ). L , CPT1 activity was measured in isolated mitochondria (n=5). Statistics were performed as 2‐way ANOVA. Individual comparisons were also performed between the fed and fasted states within genotype groups by unpaired Student t test. Data are shown as mean±SD. Not significant (ns) indicates P >0.05. * P ≤0.05, ** P ≤0.01, *** P ≤0.001. cKO indicates PFKFB2 knockout; CON, control; CPT1, carnitine palmitoyl transferase 1; PC, palmitoyl carnitine; PDH, pyruvate dehydrogenase; PDK, pyruvate dehydrogenase kinase; PFKFB2, phosphofructokinase‐2/fructose‐2,6‐bisphosphatase 2; p‐PDH, phosphorylated pyruvate dehydrogenase; Pyr, pyruvate; and Ser, serine.
Pdk2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk2/pmc12887202-10-0-3?v=Santa+Cruz+Biotechnology
Average 93 stars, based on 1 article reviews
pdk2 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology santa cruz sc
A , PDH enzyme activity was measured across groups in isolated cardiac mitochondria from fed and fasted, control and cKO hearts (n=7–9). B , Pyruvate and malate‐dependent mitochondrial respiration was measured as oxygen consumption in the ADP‐dependent state (state 3; n=7–9). C and D , Relative abundance of total PDH ( C ) and p‐PDH (serine 293; D ) were measured by western blot in the mitochondrial fraction of hearts (n=7–9). E , The ratio of p‐PDH (serine 293) to total PDH was taken. F , Representative western blots are shown for phosphorylated (serine 293) and total PDH. G , PDK4 abundance was measured by western blot in whole‐heart homogenate (n=7–9). H and I , PDK1 ( H ) and <t>PDK2</t> ( I ) abundances were measured by western blot in whole heart homogenate (n=5–6). J , Palmitoylcarnitine and malate‐dependent respiration was measured in state 3 (n=7–9). K , The ratio of PC/Pyr‐dependent State 3 respiration was calculated using measures from ( B ) and ( J ) (n=7–9). A statistical outlier in PC and malate‐dependent respiration was detected in the fed control group via a robust outlier detection test with Q=1% and excluded in panels ( J ) and ( K ). L , CPT1 activity was measured in isolated mitochondria (n=5). Statistics were performed as 2‐way ANOVA. Individual comparisons were also performed between the fed and fasted states within genotype groups by unpaired Student t test. Data are shown as mean±SD. Not significant (ns) indicates P >0.05. * P ≤0.05, ** P ≤0.01, *** P ≤0.001. cKO indicates PFKFB2 knockout; CON, control; CPT1, carnitine palmitoyl transferase 1; PC, palmitoyl carnitine; PDH, pyruvate dehydrogenase; PDK, pyruvate dehydrogenase kinase; PFKFB2, phosphofructokinase‐2/fructose‐2,6‐bisphosphatase 2; p‐PDH, phosphorylated pyruvate dehydrogenase; Pyr, pyruvate; and Ser, serine.
Santa Cruz Sc, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk2/pmc12887202-10-3-3?v=Santa+Cruz+Biotechnology
Average 93 stars, based on 1 article reviews
santa cruz sc - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

Image Search Results


A-D. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested and subjected to total RNA extraction and qPCR for the indicated genes. (A-B) n=9,11 ( Redd1) , n=12,12 ( Pdk1, Pdk2, Pdp1 ), n=10,12 ( Pdk3 ), and n=11,12 ( Pdk4, Pdp2 ), unpaired t test, 2-way ANOVA. (C-D) n=3,3,3,4 ( Redd1, Pdk1, Pdk2, Pdk3, Pdp1, Pdp2 ) and n=3,3,3,3 ( Pdk4 ), 1-way ANOVA, 2-way ANOVA. E-J. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested, lysed, and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total PDH, and plotted. (E-G) n=10,19 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. (H-J) n=5,6 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Journal: bioRxiv

Article Title: Cardiac REDD1 alters glucose and fatty acid metabolic gene expression via an mTORC1-independent, PPARα-dependent mechanism and drives hypertrophic growth

doi: 10.64898/2026.03.16.710895

Figure Lengend Snippet: A-D. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested and subjected to total RNA extraction and qPCR for the indicated genes. (A-B) n=9,11 ( Redd1) , n=12,12 ( Pdk1, Pdk2, Pdp1 ), n=10,12 ( Pdk3 ), and n=11,12 ( Pdk4, Pdp2 ), unpaired t test, 2-way ANOVA. (C-D) n=3,3,3,4 ( Redd1, Pdk1, Pdk2, Pdk3, Pdp1, Pdp2 ) and n=3,3,3,3 ( Pdk4 ), 1-way ANOVA, 2-way ANOVA. E-J. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested, lysed, and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total PDH, and plotted. (E-G) n=10,19 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. (H-J) n=5,6 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Article Snippet: 2 μg RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qPCR was performed using TaqMan Gene Expression Assays (ThermoFisher Scientific) and the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific) for the following genes: 18S (Mm03928990_g1), Redd1 (Mm00512504_g1), PDK1 (Hs05380290_s1), Pdk1 (Rn00587598_m1), PDK2 (Hs04965351_m1), Pdk2 (Rn00446679_m1), PDK3 (Hs03878443_s1), Pdk3 (Rn01424337_m1), PDK4 (Hs01037712_m1), Pdk4 (Rn00585577_m1), PDP1 (Hs01081518_s1), Pdp1 (Rn01437077_m1), PDP2 (Hs01934174_s1), Pdp2 (Mm02526496_s1), ACSL1 (Hs00960561_m1), or Nppb (Mm01255770_g1).

Techniques: RNA Extraction, Western Blot, Marker

A-D. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested and subjected to total RNA extraction and qPCR for the indicated genes. (A-B) n=9,11 ( Redd1) , n=12,12 ( Pdk1, Pdk2, Pdp1 ), n=10,12 ( Pdk3 ), and n=11,12 ( Pdk4, Pdp2 ), unpaired t test, 2-way ANOVA. (C-D) n=3,3,3,4 ( Redd1, Pdk1, Pdk2, Pdk3, Pdp1, Pdp2 ) and n=3,3,3,3 ( Pdk4 ), 1-way ANOVA, 2-way ANOVA. E-J. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested, lysed, and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total PDH, and plotted. (E-G) n=10,19 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. (H-J) n=5,6 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Journal: bioRxiv

Article Title: Cardiac REDD1 alters glucose and fatty acid metabolic gene expression via an mTORC1-independent, PPARα-dependent mechanism and drives hypertrophic growth

doi: 10.64898/2026.03.16.710895

Figure Lengend Snippet: A-D. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested and subjected to total RNA extraction and qPCR for the indicated genes. (A-B) n=9,11 ( Redd1) , n=12,12 ( Pdk1, Pdk2, Pdp1 ), n=10,12 ( Pdk3 ), and n=11,12 ( Pdk4, Pdp2 ), unpaired t test, 2-way ANOVA. (C-D) n=3,3,3,4 ( Redd1, Pdk1, Pdk2, Pdk3, Pdp1, Pdp2 ) and n=3,3,3,3 ( Pdk4 ), 1-way ANOVA, 2-way ANOVA. E-J. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested, lysed, and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total PDH, and plotted. (E-G) n=10,19 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. (H-J) n=5,6 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Article Snippet: 2 μg RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qPCR was performed using TaqMan Gene Expression Assays (ThermoFisher Scientific) and the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific) for the following genes: 18S (Mm03928990_g1), Redd1 (Mm00512504_g1), PDK1 (Hs05380290_s1), Pdk1 (Rn00587598_m1), PDK2 (Hs04965351_m1), Pdk2 (Rn00446679_m1), PDK3 (Hs03878443_s1), Pdk3 (Rn01424337_m1), PDK4 (Hs01037712_m1), Pdk4 (Rn00585577_m1), PDP1 (Hs01081518_s1), Pdp1 (Rn01437077_m1), PDP2 (Hs01934174_s1), Pdp2 (Mm02526496_s1), ACSL1 (Hs00960561_m1), or Nppb (Mm01255770_g1).

Techniques: RNA Extraction, Western Blot, Marker

A) Immunoblot analysis of senescence-associated signals p21 (normalized to ß-actin) upregulated in dcSSc FB than HC and post-ASCT (N: HC=5, dcSSc=8 and post-ASCT=6). B) After seeding equal numbers of cells, FB growth was quantified by cell counts, revealing a reduced growth rate in dcSSc FB compared with HC and post-ASCT. (N: HC=5, dcSSc=5 and post-ASCT=5, independent biological replicates). C) PDK1 and D) PDK2 mRNA levels are not different between HC and dcSSc FB as determined by qRT-PCR analysis.

Journal: bioRxiv

Article Title: A PERK-FOXO1 AXIS LINKS DNA DAMAGE TO FIBROBLAST SURVIVAL IN DIFFUSE CUTANEOUS SYSTEMIC SCLEROSIS

doi: 10.64898/2026.02.17.706443

Figure Lengend Snippet: A) Immunoblot analysis of senescence-associated signals p21 (normalized to ß-actin) upregulated in dcSSc FB than HC and post-ASCT (N: HC=5, dcSSc=8 and post-ASCT=6). B) After seeding equal numbers of cells, FB growth was quantified by cell counts, revealing a reduced growth rate in dcSSc FB compared with HC and post-ASCT. (N: HC=5, dcSSc=5 and post-ASCT=5, independent biological replicates). C) PDK1 and D) PDK2 mRNA levels are not different between HC and dcSSc FB as determined by qRT-PCR analysis.

Article Snippet: The Taqman probes (Thermo Fisher Scientific) used for qRT-PCR (with targets) included: Hs02596861_s1 (D-loop), Hs02596876_g1 (ND4), Hs02596867_s1 (CytB), Hs00231106_m1 (FOXO1), Hs02758991_g1 (GAPDH), Hs00188166_m1 (Succinate dehydrogenase or SDHA), Hs00167309_m1 (SOD2), Hs01595220_g1 (COX7C), Hs00176875_m1 (PDK4), Hs01561847_m1 (PDK1), Hs00176865_m1 (PDK2).

Techniques: Western Blot, Quantitative RT-PCR

Influence of Que on the glycolysis and energy metabolism-related protein expression level by western blotting and RT-qPCR in SHI-1 cells (mean ± SD, n = 3) . (A) Que down-regulated the expression of c-Myc, GLUT1, HK2, PKM2, LDHA, and PDK2 proteins in SHI-1 cells. (B) The expression of AMPK, mTOR, and p-mTOR protein in SHI-1 cells was significantly reduced after the treatment of Que. (C) Que decreased mRNA expression of c-Myc, GLUT1, HK2, PKM2, LDHA, and PDK2 in SHI-1 cells (mean ± SD, n=3). * P < 0.5, ** P < 0.01 vs untreated control group.

Journal: Annals of Medicine and Surgery

Article Title: Targeting aerobic glycolysis by quercetin inhibits acute monocytic leukemia SHI-1 cells

doi: 10.1097/MS9.0000000000004180

Figure Lengend Snippet: Influence of Que on the glycolysis and energy metabolism-related protein expression level by western blotting and RT-qPCR in SHI-1 cells (mean ± SD, n = 3) . (A) Que down-regulated the expression of c-Myc, GLUT1, HK2, PKM2, LDHA, and PDK2 proteins in SHI-1 cells. (B) The expression of AMPK, mTOR, and p-mTOR protein in SHI-1 cells was significantly reduced after the treatment of Que. (C) Que decreased mRNA expression of c-Myc, GLUT1, HK2, PKM2, LDHA, and PDK2 in SHI-1 cells (mean ± SD, n=3). * P < 0.5, ** P < 0.01 vs untreated control group.

Article Snippet: The membranes were incubated with primary antibodies, including c-Myc (1:1000), GLUT1 (1:2000), HK2 (1:1000), PKM2 (1:2000), LDHA (Hangzhou HuaAn Biotechnology Co., Ltd; 1:800 M1007-7), pyruvate dehydrogenase kinase 2 (PDK2) (Hangzhou Jingjie Biotechnology Co., LTD; 1:1000; PTM-6321), AMPK (Hangzhou HuaAn Biotechnology Co.,Ltd; 1:1000; HA600078), mTOR (Hangzhou Jingjie Biotechnology Co., LTD; 1:1000; PTM-6594), p-mTOR (Hangzhou HuaAn Biotechnology Co.,Ltd; 1:2000; HA600094), and β-actin (Proteintech Group, Inc; 1:10 000; 66009-1-lg) overnight at 4°C.

Techniques: Expressing, Western Blot, Quantitative RT-PCR, Control

A , PDH enzyme activity was measured across groups in isolated cardiac mitochondria from fed and fasted, control and cKO hearts (n=7–9). B , Pyruvate and malate‐dependent mitochondrial respiration was measured as oxygen consumption in the ADP‐dependent state (state 3; n=7–9). C and D , Relative abundance of total PDH ( C ) and p‐PDH (serine 293; D ) were measured by western blot in the mitochondrial fraction of hearts (n=7–9). E , The ratio of p‐PDH (serine 293) to total PDH was taken. F , Representative western blots are shown for phosphorylated (serine 293) and total PDH. G , PDK4 abundance was measured by western blot in whole‐heart homogenate (n=7–9). H and I , PDK1 ( H ) and PDK2 ( I ) abundances were measured by western blot in whole heart homogenate (n=5–6). J , Palmitoylcarnitine and malate‐dependent respiration was measured in state 3 (n=7–9). K , The ratio of PC/Pyr‐dependent State 3 respiration was calculated using measures from ( B ) and ( J ) (n=7–9). A statistical outlier in PC and malate‐dependent respiration was detected in the fed control group via a robust outlier detection test with Q=1% and excluded in panels ( J ) and ( K ). L , CPT1 activity was measured in isolated mitochondria (n=5). Statistics were performed as 2‐way ANOVA. Individual comparisons were also performed between the fed and fasted states within genotype groups by unpaired Student t test. Data are shown as mean±SD. Not significant (ns) indicates P >0.05. * P ≤0.05, ** P ≤0.01, *** P ≤0.001. cKO indicates PFKFB2 knockout; CON, control; CPT1, carnitine palmitoyl transferase 1; PC, palmitoyl carnitine; PDH, pyruvate dehydrogenase; PDK, pyruvate dehydrogenase kinase; PFKFB2, phosphofructokinase‐2/fructose‐2,6‐bisphosphatase 2; p‐PDH, phosphorylated pyruvate dehydrogenase; Pyr, pyruvate; and Ser, serine.

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: PFKFB2 Is Pivotal for Metabolic Flexibility and Differential Glucose Utilization

doi: 10.1161/JAHA.125.043921

Figure Lengend Snippet: A , PDH enzyme activity was measured across groups in isolated cardiac mitochondria from fed and fasted, control and cKO hearts (n=7–9). B , Pyruvate and malate‐dependent mitochondrial respiration was measured as oxygen consumption in the ADP‐dependent state (state 3; n=7–9). C and D , Relative abundance of total PDH ( C ) and p‐PDH (serine 293; D ) were measured by western blot in the mitochondrial fraction of hearts (n=7–9). E , The ratio of p‐PDH (serine 293) to total PDH was taken. F , Representative western blots are shown for phosphorylated (serine 293) and total PDH. G , PDK4 abundance was measured by western blot in whole‐heart homogenate (n=7–9). H and I , PDK1 ( H ) and PDK2 ( I ) abundances were measured by western blot in whole heart homogenate (n=5–6). J , Palmitoylcarnitine and malate‐dependent respiration was measured in state 3 (n=7–9). K , The ratio of PC/Pyr‐dependent State 3 respiration was calculated using measures from ( B ) and ( J ) (n=7–9). A statistical outlier in PC and malate‐dependent respiration was detected in the fed control group via a robust outlier detection test with Q=1% and excluded in panels ( J ) and ( K ). L , CPT1 activity was measured in isolated mitochondria (n=5). Statistics were performed as 2‐way ANOVA. Individual comparisons were also performed between the fed and fasted states within genotype groups by unpaired Student t test. Data are shown as mean±SD. Not significant (ns) indicates P >0.05. * P ≤0.05, ** P ≤0.01, *** P ≤0.001. cKO indicates PFKFB2 knockout; CON, control; CPT1, carnitine palmitoyl transferase 1; PC, palmitoyl carnitine; PDH, pyruvate dehydrogenase; PDK, pyruvate dehydrogenase kinase; PFKFB2, phosphofructokinase‐2/fructose‐2,6‐bisphosphatase 2; p‐PDH, phosphorylated pyruvate dehydrogenase; Pyr, pyruvate; and Ser, serine.

Article Snippet: PDK2 , , Santa Cruz: sc‐100 534 , 1:500 , 1:2000.

Techniques: Activity Assay, Isolation, Control, Western Blot, Knock-Out